circad | circRNAs associated with diseases

hsa_circ_0002113
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Pulmonary Tuberculosis	ICD-10	Respiratory tuberculosis, bacteriologically and histologically confirmed (A15)
DBLink	Link to database	PMID	29248507
Experimental Method
Sample Type	Peripheral Blood Mononuclear Cells (PBMCs)	Comparison	Two subjects with Active Pulmonary Tuberculosis (APTB) and two age- and gender-matched healthy controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTTTCACACTCCACCAAGCA Reverse CGGCAGTGAAGTCACACTCT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Qian, Z, Liu, H, Li, M, Shi, J, Li, N, Zhang, Y, Zhang, X, Lv, J, Xie, X, Bai, Y, Ge, Q, Ko, EA, Tang, H, Wang, T, Wang, X, Wang, Z, Zhou, T, Gu, W (2018). Potential Diagnostic Power of Blood Circular RNA Expression in Active Pulmonary Tuberculosis. EBioMedicine, 27:18-26.